| Subject: | report a bug |
| Date: | Wed, 16 Dec 2009 19:30:16 +0100 |
| To: | <bug-Algorithm-LCSS [...] rt.cpan.org> |
| From: | "Steffen Priebe" <Steffen.Priebe [...] hki-jena.de> |
Hello,
the method LSCC of module Algorithm::LCSS should report the longest common sub sequence.
But it seems to me that it works not correctly in special case. Example:
my $lcss_string = LCSS( "CAGAGTTCTACAGTCCGACGATCACTAA", "ACCGACGATCACTATCGTACGACTCTTAGCAAGCAGA" ); # string
print $lcss_string."\n";
Will get this output:
ACGA
But the longest common subsequence is actually: CCGACGATCACTA
With kind regards,
Steffen Priebe
The information contained in this email and any attachments is confidential and may be subject to copyright or other intellectual property protection. If you are not the intended recipient, you are not authorized to use or disclose this information, and we request that you notify us by reply mail or telephone and delete the original message from your mail system.